به کریستال ویوله (Crystal Violet; CV) انجام شد (Stepanovic. 2000) .
برای بررسی تشکیل بیوفیلم این باکتری، ابتدا یک لوپ پر از کلنی باکتری را به یک لوله حاوی 5 میلی لیتر لوریا برتانی (LB)تلقیح و این لوله به مدت 18 تا 24 ساعت در دمای 37 درجه سانتیگراد گرماگذاری شد. بعد از گذشت این مدت و فعال شدن باکتری ها، 1میلی لیتر از سوسپانسیون باکتری برداشته و به لوله آزمایش حاوی 10 میلی لیتر محیط استریل LB تلقیح شد. سپس 200 میکرولیتر از محیط 10 میلی لیتری برداشته و داخل چاهک های میکروتیتر پلیت ریخته شد. در چاهک شاهد فقط محیط کشت استریل LB قرار داده شد. جنس میکروتیترپلیت ها از پلی استیرن می باشد و هر کدام دارای 8 ردیف و 12 ستون میباشد. بعد ازتلقیح درب پلیت گذاشته شد و گرماگذاری به مدت 24 ساعت در 37 درجه سانتیگراد صورت گرفت.
بعد از گذشت این مدت، محتوی داخل چاهک ها خالی شد و شستشوی چاهک ها 3 بار با سرم فیزیولوژی استریل انجام شد. پلیت ها به شدت تکان داده شدند تا سلول های غیر متصل حذف شوند. سپس 200 میکرولیتر اتانول 96% به چاهک ها اضافه گردید تا سلول ها تثبیت گردند. بعد از گذشت 15 دقیقه، محتوبات چاهک ها تخلیه شد و در دمای آزمایشگاه سطح پلیت ها خشک گردید. سپس هر چاهک را با 200 میکرولیتر از کریستال ویوله 2% (CV) به مدت 5 دقیقه رنگ شد. بعد از 5 دقیقه ، چاهک ها با آب شهری به آرامی شسته شد و با 200 میکرولیتر اسید استیک 33% به عنوان حلال پر شدند و بعد از 15 دقیقه انکوباسیون پلیت ها در دمای 37 درجه سانتیگراد جذب نوری چاهک های رنگ شده با کریستال ویوله در 492 نانومتر توسط دستگاه ELYSA Reader خوانده شد.
جدول 3_1 : فرمول مورد نیاز برای تولید بیوفیلم
Formula
Strong ( s)
Moderate ( M)
Weak (W)
Negative (N)

BF= AB – CW
? 0.300
0.200 – 0.299
0.100 – 0.199
0.100

BF: Biofilm Formation; AB:Stained attached Bacteria; CW: Stained Control Wells.
Value : OD492nm

3-7- بررسی هیدروفوبیسیتی UPEC با استفاده ازهیدروکربن اکتان
(Microbial Adhesion to Hydrocarbon; MATH)
خاصیت هیدروفوبیسیتی سطح سلول های باکتری های بیماریزا یکی از عوامل موثر در اتصال این باکتری ها به حساب می آید. دراین تحقیق از آزمایش اتصال سلول‌های باکتری به هیدروکربن اکتان به عنوان یک سطح مورد اتصال( MATH ) جهت سنجش هیدروفوبیسیتی استفاده شد.
جهت انجام آزمایش از بافر فسفات (PBS) با ترتیب زیر تهیه شد:
Nacl 8 g
KH2PO4 0/2 g
Na2HPO4.12H2O 2/9 g
Kcl 0/2 g
d H2O 1000 ml
pH 7/2 – 7/1

به منظور بررسی قدرت اتصالی یا هیدروفوبیسیتی UPEC ، ابتدا یک کشت 18 تا 20 ساعته از باکتری در لوله های حاوی محیط کشت لوریا برتانی براث در دمای ? 37 تهیه گردید. سپس به منظور جمع آوری سلول های باکتری، لوله ها به وسیله دستگاه ساتنریفیوژ با دور rpm5000 ، دمای ? 20 به مدت 10 دقیقه سانتریفیوژ شدند. مایع رویی خارج و به رسوب حاصل بافر فسفات(PBS) اضافه گردید. از رسوب سوسپانسیونی با کدورت معادل نیم مک فارلند تهیه شد. در مرحله بعدی 5/3 میلی لیتر از سوسپانسیون برداشته و به لوله کووت منتقل شد و جذب نوری آن درطول موج 640 نانومتر خوانده شد. این جذب نوری به عنوان جذب نوری اولیه یا A گزارش گردید. سپس 5/0میلی لیتر از هیدروکربن اکتان به هر سوسپانسیون اضافه وبه مدت 120 ثانیه با دور متوسط ورتکس شد. عمل ورتکس کردن برای افزایش سطح اتصال باکتری های موجود در سوسپانسیون و هیدروکربن اکتان می باشد. سپس لوله ها به مدت 15 دقیقه در یک محل بدون حرکت قرار داده شد تا فاز آبی و آلی از هم جدا شوند. سپس جذب نوری فاز آبی در طول موج 640 نانومتر خوانده شد و به عنوان جذب ثانویه یا B ثبت گردید.
نتایج حاصله به صورت درصد هیدروفوبیسیتی یا اتصال سلول های باکتری به هیدروکربن اکتان محاسبه شد (Mel.Rosenberg.1981).

100 * / A B ) – = ( A درصد سلولهای اتصال به هیدروکربن
A: : جذب نوری اولیه
: Bجذب نوری نهایی
3-8- استخراج DNA با استفاده از کیت استخراج DNA شرکت سینا ژن
استخراج DNA باکتری اشریشیا کلی با استفاده از کیت استخراج DNA شرکت سیناژن با کمی تغییرات انجام شد.
ابتدا یک کشت 18 تا 24 ساعته از باکتری در محیط کشت لوریا برتانی براث ( LB Broth) داده شد. سپس 700 _ 500 میکرولیتر ازسوسپانسون باکتری به میکروتیوب هایml 5/1 منتقل گردید. میکروتیوب های حاوی باکتری به مدت 3 دقیقه در دور 5000 rpm میکروفیوژ شدند. سپس محلول رویی تخلیه و با نوک انگشت ضربات آرامی به رسوب وارد شد. بعد از حل شدن رسوب، 400 میکرولیتر بافر لیز اضافه و 10 بار پیپتاژ گردید. بعد از میکروفیوژ کردن به مدت 2 دقیقه در دورrpm 12000 ، محلول رویی به میکروتیوب جدید منتقل شد و 300 میکرولیتر محلول رسوب گذاری به آن اضافه گردید. میکروتیوب ها به مدت 20 دقیقه در فریزر منهای 20 قرار داده شدند. بعد از گذشت این مدت، 5 دقیقه در دور rpm 10000 میکروفیوژ گردید. سپس محلول رویی تخلیه و رسوب خشک شد. 1 میلی لیتر بافر شستشو جهت کنده شدن رسوب و زدودن نمک های اضافی به رسوب اضافه شد. سپس به مدت 1 دقیقه در دور rpm 10000 میکروفیوژ گردید. محلول رویی خالی و رسوب به طور کامل خشک گردید، سپس 50 میکرولیتر حلال به میکروتیوب اضافه و با ضربات آرام نوک انگشت بعد از دقایقی رسوب در حلال حل گردید.
DNA حاصل برای مراحل بعدی کار و انجام فرایند PCR در فریزر منهای 20 ذخیره گردید.
3-9- تعیین کیفیت DNA با استفاده از الکتروفورز بر روی ژل آگاروز
در این روش 5 میکرولیتر از DNA استخراج شده به همراه 1 میکرولیتر Loading buffer در ژل آگاروز یک درصد (1%) بارگذاری شد. پس از انجام الکتروفورز به مدت یک ساعت با ولتاژ 80 ولت، کیفیت باند ها با استفاده از دستگاه ترانس الومیناتور مورد بررسی قرار گرفت.
3-10- PCR چند گانه (Multiplex PCR)
تمامی مواد واکنش PCR از شرکت سیناژن تهیه شد که به شرح زیر است .
1- بافر ( PCR ) که در غلظت X10 وجود دارد و حاوی Tris – Hcl و kcl است .
2- کلرید منیزیم (2MgCl): از این جهت در انجام واکنش PCR ضروری است که آنزیم Taq پلی مراز در حضور یون Mg+2 فعالیت می کند و شدیداً به این یون وابسته است . میزان غلظت منیزیم با میزان غلظت dNTP همواره رابطه مستقیم دارد . اگر از غلظت بیشتر dNTP استفاده گردد باید بطور مناسب از غلظت منیزیم بیشتری استفاده شود. در غلظت پایین Mg+2 و غلظت بالای dNTP دیگر یون منیزیم برای آنزیم Taq پلیمراز باقی نخواهد ماند و این عمل باعث اختلال در دقت آنزیم Taq پلیمراز می‌گردد.
3- نوکلوئیدها : چهار نوکلوئید آدنین – تیمدین – گوانین و سیتوزین با غلظت‌های مشخص و یکسان با یکدیگر مخلوط و محلول dNTP را تشکیل می دهند . این محلول باید در دمای ?20 – نگهداری شود . اگر غلظت dNTP در محلول PCR خیلی زیاد باشد، باعث کاهش دقت در عملکرد PCR می‌گردد . یعنی آنزیم Taq پلیمراز ممکن است به علت فراوانی بیش از حد هر کدام از این نوکلوئید‌ها ، اشتباهاً نوکلوئید نامناسبی را انتخاب نماید. اگر غلظت dNTP کم باشد باعث کاهش در کارایی PCR می‌گردد. در یک PCR استاندارد معمولاً از غلظت 2/0 میلی مولار dNTP استفاده می شود.
4- آنزیم Taqپلیمراز : هنگام سنتز DNA ، آنزیم DNA پلیمراز با انتخاب صحیح نوکلوئیدها و اضافه کردن آنها به انتهای پرایمر باعث ایجاد یک زنجیره جدید DNA می‌شود .
همواره این آنزیم سنتز 3َ ? 5َ را کاتالیز می نماید . این آنزیم از باکتری Thermus aquaticus گرفته شده و برای PCR استفاده می‌شود . این آنزیم در دمای بالا مقاومت خوبی داشته و بیشترین فعالیت آن در 73 تا 75 درجه سانتیگراد است . وزن مولکولی Taq پلیمراز 94 کیلو دالتون می‌باشد و توانایی اتصال 50 تا 60 نوکلوئید را در یک ثانیه دارد . عمر این آنزیم در 95 درجه سانتیگراد حدود 40 دقیقه است . غلظت های تجاری این آنزیم 5 واحد در هر میکرولیتر و یا یک واحد در هر میکرولیتر است .
5- پرایمرها : در این آزمایش از پرایمرهای اختصاصی برای ژن های pap و sfa استفاده شد .محصول PCR ژن های مورد نظر با این جفت پرایمرها 328 و 410 جفت باز بود. توالی جفت پرایمرهای مورد استفاده در این آزمون PCR درجدول 3-1 آمده است.

این مطلب رو هم توصیه می کنم بخونین:   دانلود پایان نامه دربارهبازرگانان، طلاق، حمل و نقل

جدول3-2 : پرایمرهای استفاده شده در Multiplex PCR برای تعیین ژنهای ویرولان pap و sfa
Size of product(bp)
Primer sequences 5’_3′
Primer
No
328

410
GACGGTGTACTGCAGGGTGTC
ATATCCTTTCTGCAGGGATGCAA

CTCCGGAGAACTGGGTGCATCT
CGGAGGAGTAATTACAAACCTGC
pap (F)
pap (R)

sfa (F)
sfa (R)
1

2

واکنش PCR با حجم نهایی 25 میکرولیتر شامل 3.95 میکرولیتراز Master Mix ( حاوی2.5 میکرولیتر بافر واکنش گر( PCR بافر) ،0.75 میکرولیتر mgcl2، 0.5 میکرولیتر مخلوط dNTP و 0.2 واحد آنزیم DNA Taq Polymerase ) 1 میکرولیتر DNAی الگو، 1 میکرولیتر از هر یک از پرایمرهای (Forward و Reverse) pap و sfa و 16.05 میکرولیتر آب مقطر استریل بود. (جدول 3-2)
جدول شماره3-3 : دستور العمل انجام واکنش PCR تا حجم 25 میکرولیتر

غلظت اولیه
غلظت نهایی
حجم
بافر واکنش‌گر
X 10
X 1
?l 5/2
پرایمر ( R + F )
PM 100
PM 5
?l 25/1
2 MgCl
mM 50
mM 5/1
?l 75/0
مخلوط dNTP
mM 10
mM 2/0
?l 5/0
Taqپلیمراز
u ?l- 5
u ?l- 2/1
?l 2/0
DNA

?g 1- 1/0
?l 1
آب

تا حجم ?l 25
مراحل برنامه تکثیرژنهایpap و sfa دردستگاه ترموسایکلر شامل واسرشت اولیه (Denaturation) در 94 درجه سانتیگراد به مدت 4 دقیقه، پس از آن 32 سیکل شامل 3 مرحله انکوباسیون در 94 درجه سانتیگراد به مدت 30 ثانیه، اتصال (Annealing) در 54 درجه سانتیگراد به مدت 30 ثانیه و مرحله بسط (Extention) در 72 درجه سانتیگراد به مدت 1 دقیقه و سپس یک مرحله بسط نهایی در 72 درجه سانتیگراد به مدت 5 دقیقه انجام گرفت.( جدول شماره 3-3) ( ارباب سلیمانی، 1390).

جدول شماره 3-4: مراحل برنامه تکثیر ژن های pap و sfa در دستگاه ترموسایکلر
زمان
حرارت( سانتیگراد)
مراحل
4′
94
واسرشت اولیه ( دناتوراسیون)
30”
94
دمای جدا شدن دو رشته ( دناتوراسیون)
30”
54
دمای هیبرید شدن ( اتصال)
1′
72
دمای پیشروی
5′
72
بسط نهایی ( اکستنشن)
3-11- الکتروفورز ژل آگارز
الکتروفورز فرایند حرکت مولکول‌های باردار در میدان الکتریکی است.در این فرایند خصوصیات فیزیکوشیمیایی مولکول‌ها نقش موثر دارند . آگارز پلی‌مری از دو نوع قند مشتق از گالاکتوز است که معمولاً بصورت پودر موجود می‌باشد . منافذ ژل آگارز به غلظت آن بستگی دارد . دامنه غلظت آگارز در روش های مختلف از %4/0 تا 4% است و قطر منافذ از nm 100 تا nm 300 متغییر است . در این تحقیق برای الکتروفورز DNA از ژل آگارز 1% استفاده شد .
موادی که در این روش مورد استفاده قرار گرفت به شرح زیر است :
1 – پودر آگارز که از شرکت سیناژن تهیه شد .
2 – بافر X 10 TBE
Tris- base 4/5 g
Boric acid 75/2 g
EDTA 46/0 g
ddH2o 50 mlتا

دسته‌ها: No category

دیدگاهتان را بنویسید